Skip to content

Metagenomics Pipeline

ADToolbox converts metagenomics evidence into model-ready e-ADM microbial COD allocations from a sample table. The current pipeline is exposed through the adtoolbox metagenomics process CLI command and supports:

  • SRA accession tables
  • local FASTQ/FASTQ.GZ read tables
  • raw amplicon reads processed with fastp, Cutadapt, and standalone DADA2
  • shotgun reads aligned directly to the ADToolbox protein database with MMseqs2

Each sample row writes a dedicated output folder containing clean result CSVs, pipeline.log, and provenance.json. Generated command scripts, raw alignment files, DADA2 intermediates, and other working files are kept under that sample's scratch/ folder.

Batch runs also write workflow_state.json and workflow_events.jsonl under --output-dir. These files keep a durable record of each sample and stage, so interrupted runs can be resumed and cached outputs can be skipped.

flowchart TB
    A["Raw reads<br>SRA or local FASTQ"] --> B["Quality-trimmed reads<br>fastp"]
    B --> C["Amplicon:<br>Cutadapt + DADA2"]
    C --> D["VSEARCH vs GTDB<br>representative genomes"]
    D --> E["Genome MMseqs2<br>functional profiles"]
    B --> F["Shotgun:<br>read MMseqs2 translated search"]
    E --> G["cod_profile.csv<br>reaction metadata"]
    F --> G

New to the pipeline? The Quickstart has a shorter, worked example. This page is the complete reference.

Amplicon Reads

Raw amplicon reads are handled in four stages:

  1. Trim adapters, low-quality tails, and short reads with fastp. Explicit adapters can be supplied, otherwise fastp auto-detects common adapters. Paired runs retain passing orphan mates for an automatic R1-only fallback.
  2. Detect a known universal primer pair and remove it with Cutadapt.
  3. Infer exact ASVs, merge paired reads, and remove chimeras with standalone DADA2.

After paired fastp filtering, ADToolbox compares the surviving pair count with min_reads_for_denoising. When enough pairs remain, Cutadapt and DADA2 run paired-end. When the pair count is below the threshold but at least that many valid R1 reads remain, allow_single_end_fallback = true selects single-end R1 Cutadapt and DADA2 automatically. The decision and counts are written to scratch/amplicon_preprocess/read-selection.json; read-layout.txt carries the runtime choice between the dependent Slurm tasks. If neither layout has enough reads, trimming exits with non-retryable status 64 and the other samples continue. 4. Map representative sequences to GTDB, connect genomes to ADToolbox protein alignments, and aggregate the resulting e-ADM COD allocation.

This path does not install or invoke QIIME2. DADA2 is called directly through Rscript; VSEARCH remains a separate lightweight dependency for mapping the resulting representative sequences to GTDB.

Universal primer catalog

With primer_mode = "auto", ADToolbox checks the starts of both read directions against the packaged catalog at adtoolbox/pkg_data/amplicon_primers.tsv. Detection supports IUPAC ambiguity codes, sequencing errors, and short leading heterogeneity spacers. A pair is accepted only when both read directions pass primer_min_fraction (0.80 in the reference profile). The selected pair and the top candidate scores are saved in scratch/amplicon_preprocess/detected_primers.json.

The catalog is a tab-separated file with name, forward_primer, reverse_primer, and target_region columns. To use a larger or project-specific catalog, set primer_catalog in [steps.build_amplicon_features.settings]. A primer pair can also be supplied for one sample by adding forward_primer and reverse_primer columns to the manifest, or for the whole run with the matching CLI options. Explicit primers override automatic detection.

If no pair passes the threshold, the sample fails before Slurm submission with candidate scores in the error message. This is deliberate: continuing with an unknown primer layout can create an empty or misleading ASV table.

The main preprocessing artifacts are:

  • feature-table.tsv — per-sample ASV counts
  • rep-seqs.fasta — ASV sequences with stable sequence-derived IDs
  • dada2-stats.tsv — input, filtered, denoised, merged, and non-chimeric read counts
  • detected_primers.json and <sample>_cutadapt.json — primer audit and trimming report
  • read-selection.json and read-layout.txt — fastp paired/single-end decision, thresholds, and retained read counts

For local reads, use a table with sample, read_1, and optionally read_2:

sample  read_1  read_2
sample_01   ./fastq/sample_01_R1.fastq.gz   ./fastq/sample_01_R2.fastq.gz
sample_02   ./fastq/sample_02_R1.fastq.gz   ./fastq/sample_02_R2.fastq.gz

For SRA samples, use a table with sample and accession:

sample  accession
sample_01   SRR28403133
sample_02   SRR28403134
adtoolbox metagenomics process \
  --input ./metagenomics/read_samples.tsv \
  --input-type reads \
  --assay amplicon \
  --output-dir ./metagenomics/process \
  --adapter-1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \
  --adapter-2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \
  --amplicon-to-genome-db ./database/amplicon_to_genome \
  --genomes-dir ./metagenomics/genomes \
  --reaction-db ./database/Reaction_Metadata.csv \
  --execution-profile reference_data/metagenomics_pipeline.toml \
  --execute

For SRA tables, use the same command with --input-type sra and an SRA download directory:

adtoolbox metagenomics process \
  --input ./metagenomics/sra_samples.tsv \
  --input-type sra \
  --assay amplicon \
  --output-dir ./metagenomics/process \
  --sra-dir ./metagenomics/sra \
  --amplicon-to-genome-db ./database/amplicon_to_genome \
  --genomes-dir ./metagenomics/genomes \
  --reaction-db ./database/Reaction_Metadata.csv \
  --execution-profile reference_data/metagenomics_pipeline.toml \
  --execute

Shotgun Reads

Shotgun mode turns read-level functional evidence directly into the e-ADM COD allocation:

  1. Download SRA reads when needed.
  2. Trim adapters, low-quality tails, and short reads with fastp.
  3. Submit one align_short_reads MMseqs2 translated-search job for the sample. For paired-end data, both trimmed mates are added to the same query database.
  4. Filter hits by --e-value and --bit-score, count each unique query/EC pair, map ECs through Reaction_Metadata.csv, and write the normalized microbial-group profile.

It skips primer detection, Cutadapt, DADA2, GTDB, genome downloads, and genome alignments. This route is functional rather than taxonomic: its clean outputs are ec_counts.csv and cod_profile.csv.

The local-read manifest has sample, read_1, and optional read_2 columns. A paired column can explicitly select paired or single-end handling. When paired is true, read_2 is required.

adtoolbox metagenomics process \
  --input ./metagenomics/shotgun_samples.tsv \
  --input-type reads \
  --assay shotgun \
  --output-dir ./metagenomics/process \
  --protein-db ./database/Protein_DB.fasta \
  --reaction-db ./database/Reaction_Metadata.csv \
  --sample-workers 4 \
  --execution-profile reference_data/metagenomics_pipeline.toml \
  --execute

For SRA, use the same two-column sample/accession table as the amplicon route, change --input-type to sra, and provide --sra-dir.

All MMseqs query, result, and temporary databases are written under <output>/<sample>/scratch/shotgun_alignment/; source FASTQ directories are never used as work directories. A prebuilt protein_db_mmseqs beside the protein FASTA is reused. If it is absent, each sample job builds a private target database from Protein_DB.fasta, so the CLI still works without a separate database-building command. On success, the large mmseqs_work directory is removed by default while the alignment TSV is retained. Set steps.align_short_reads.settings.keep_work = true to retain it; failed work directories are always left in place for debugging.

Successful read-input signatures are stored in scratch/shotgun_downstream_inputs.json. A rerun reuses the trimmed reads, alignment, and COD profile when the inputs are unchanged; changing a trimmed read invalidates the downstream cache.

Execution Profiles

Use a TOML execution profile to choose local or Slurm execution per step. The reference profile is reference_data/metagenomics_pipeline.toml.

The reference profile uses container = "None", so commands run from the active Conda environment on the compute node. Container image selection remains available through a top-level or step-specific image key when Docker or Apptainer is wanted.

Slurm steps use sbatch --wait --parsable. The application waits for each task to finish, validates its outputs, and only then starts the next task for that sample. It does not use Slurm dependency directives.

Sample pipelines run concurrently with a bounded worker pool. --sample-workers 4 is the default: up to four samples can be active at once, while the tasks inside each sample remain strictly sequential. Set it to 1 for serial execution or lower it when scheduler or download limits require less concurrency.

Each named task is one Slurm job per sample. In particular, align_genomes contains all required genome-to-protein MMseqs alignments for that sample and runs them sequentially inside one job. Completed alignment files are reused on retries and reruns. Each MMseqs command receives a unique absolute temporary directory under scratch/genome_alignments/mmseqs_tmp/<genome_accession>.

Slurm retries are opt-in. Set retries under [slurm] for a global default, or under a specific [steps.<name>] table for one step. Every attempt is a separate sbatch --wait submission with its own Slurm job ID. A failed, timed-out, preempted, or manually cancelled attempt returns control to ADToolbox; after retry_delay_seconds, ADToolbox submits a fresh job. The generated sbatch script contains the task once and has no Bash retry loop.

To stop a task permanently, stop the controlling adtoolbox metagenomics process command before calling scancel. If the controller remains alive, a manually cancelled attempt is treated like another retryable Slurm failure and may be resubmitted.

Exit status 64 marks a deterministic no-feature result, such as DADA2 retaining no non-chimeric ASVs. Status 127 marks a missing executable or DADA2 R dependency. Those statuses are not resubmitted because another allocation cannot fix them. Other failures, including cancellation, retain the configured retry behavior.

When all retries are exhausted, ADToolbox marks that sample and stage as failed, records the error in batch_summary.json and the workflow log, skips the remaining tasks for that sample, and continues with the next sample in the manifest.

For each sample, download_genomes deduplicates missing assembly accessions and uses one NCBI Datasets dehydrated package plus datasets rehydrate instead of submitting one download per genome. Set steps.download_genomes.settings.max_workers between 1 and 30 to bound concurrent transfers; the default is 10. Genomes already present in --genomes-dir are not downloaded again. If either NCBI Datasets or unzip is unavailable, the same task automatically falls back to sequential HTTPS downloads from the NCBI assembly archive.

Unavailable, suppressed, or deprecated assembly accessions are skipped individually and recorded in scratch/genome_download/failed_genomes.txt and the sample provenance as skipped_genome_fastas. Valid genomes continue through alignment and COD calculation. A sample for which no requested genome is available finishes as completed_no_available_genomes instead of retrying indefinitely.

Important step names are:

  • download_sra
  • download_genomes
  • trim_reads
  • build_amplicon_features
  • align_to_gtdb
  • align_genomes
  • align_short_reads

Without --execute, ADToolbox writes scripts and Slurm files but does not run or submit them.

Final COD files are only written when real upstream data exists. If a required alignment or amplicon intermediate is missing, the sample is marked with a waiting status in the workflow state instead of silently completing. Amplicon GTDB/COD caches are tied to a SHA-256 signature of the feature table and representative FASTA. Shotgun alignment/COD caches are tied to the resolved paths, sizes, and modification times of the trimmed reads.

When a DADA2 profile is selected, legacy VSEARCH feature-table.tsv and rep-seqs.fasta files are not considered a complete preprocessing cache unless the DADA2 statistics and primer audit are also present. Read downloads, genome FASTAs, and compatible genome-to-protein alignments can still be reused.

Stages

Both the CLI and the Python API can run one stage at a time. In the usual Slurm setup, --stage all waits for each submitted step and runs the full sample pipeline through downstream amplicon-to-genome mapping and COD allocation.

Stage Does
download Fetch reads from SRA. Skipped for local read tables.
preprocess Both: quality-trim with fastp. Amplicon additionally removes primers with Cutadapt and infers ASVs with DADA2.
allocate (CLI) / cod (Python) Amplicon: GTDB/genome work and COD. Shotgun: align trimmed reads with MMseqs2 and calculate EC/COD tables.
all Run every applicable stage in order.

The last stage has two names

The CLI option is --stage allocate, but batch_sample_to_cod expects stage="cod". The CLI translates between them; passing "allocate" directly to the Python API raises ValueError.

Python Step API

Each external step can also be called directly from Python. The direct step methods use the same TOML execution profile and return the same artifact structure used by the CLI.

from adtoolbox import configs, core

mg = core.Metagenomics(configs.Metagenomics(database_dir="./database"))

trim = mg.run_trim_reads_step(
    sample_name="sample_01",
    output_dir="./metagenomics/process",
    read_1="./metagenomics/sample_01/R1.fastq.gz",
    read_2="./metagenomics/sample_01/R2.fastq.gz",
    adapter_1="AGATCGGAAGAGCACACGTCTGAACTCCAGTCA",
    adapter_2="AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT",
    execution_profile="reference_data/metagenomics_pipeline.toml",
    execute=False,
)

features = mg.run_build_amplicon_features_step(
    sample_name="sample_01",
    output_dir="./metagenomics/process",
    read_1=trim["artifacts"]["trimmed_reads"]["read_1"],
    read_2=trim["artifacts"]["trimmed_reads"]["read_2"],
    execution_profile="reference_data/metagenomics_pipeline.toml",
    execute=False,
)

Available direct step methods:

Running the whole batch from Python

The CLI is a thin wrapper around batch_sample_to_cod, which takes the same options as keyword arguments:

from adtoolbox import configs, core

mg = core.Metagenomics(
    configs.Metagenomics("./metagenomics/process", database_dir="./database")
)

result = mg.batch_sample_to_cod(
    manifest="./metagenomics/read_samples.tsv",
    assay="amplicon",
    input_type="reads",
    output_dir="./metagenomics/process",
    stage="all",
    amplicon_to_genome_db="./database/Amplicon2GenomeDBs",
    genomes_dir="./metagenomics/genomes",
    execution_profile="reference_data/metagenomics_pipeline.toml",
    execute=True,
)

print(result["samples"])   # per-sample artifact paths
print(result["summary"])   # path to batch_summary.json

For shotgun data, set assay="shotgun"; amplicon_to_genome_db and genomes_dir are then unnecessary.

For a single sample, sample_to_cod runs the same logic without the manifest.

See also